plasmids expressing cas9 pdd162 (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
plasmids expressing cas9 pdd162
Plasmids Expressing Cas9 Pdd162, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 259 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+plasmid/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pm41896213-178-26-31
Average 95 stars, based on 259 article reviews
Plasmids Expressing Cas9 Pdd162, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 259 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+plasmid/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pm41896213-178-26-31
Average 95 stars, based on 259 article reviews
plasmids expressing cas9 pdd162 - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Construct:Article Title: Enhanced production of sabinene by engineered Saccharomyces cerevisiae from corn hydrolysates Article Snippet: recently, advanced biofuels [1–3].. IPP and DMAPP, derived from both the mevalonate (MVA) pathway and methylerythritol phosphate (MEP) pathway, are condensed to geranyl diphosphate (GPP, precursor to monoterpene) by GPP synthase, which is further converted to monoterpene by various monoterpene synthases [4, 5].. Sabinene is a type of bicyclic monoterpene found in a variety of essential oils of plants, including Salvia officinalis and Origanum species, and is widely used in culinary spices, perfume additives and fine chemicals [6–9]. Expressing:Article Title: Enhanced production of sabinene by engineered Saccharomyces cerevisiae from corn hydrolysates Article Snippet: recently, advanced biofuels [1–3].. IPP and DMAPP, derived from both the mevalonate (MVA) pathway and methylerythritol phosphate (MEP) pathway, are condensed to geranyl diphosphate (GPP, precursor to monoterpene) by GPP synthase, which is further converted to monoterpene by various monoterpene synthases [4, 5].. Sabinene is a type of bicyclic monoterpene found in a variety of essential oils of plants, including Salvia officinalis and Origanum species, and is widely used in culinary spices, perfume additives and fine chemicals [6–9]. Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Article Title: Development of Potent and Selective RIPK1 Degraders Targeting Its Non-Enzymatic Function for Cancer Treatment Article Snippet: .. 26 Guide RNA oligos for RIPK1 (foward: CACCGAGCCCATCCAGGGTTAGTTC. reverse: AAACGAACTAACCCTGGATGGGCTC) were cloned into Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Article Title: Loss of PTDSS1 in tumor cells improves immunogenicity and response to anti-PD-1 therapy. Article Snippet: .. Mouse bladder cancer cell line MB49 (Sigma- Aldrich, SCC148) was first transduced with Article Title: Mucin-type O -glycans regulate proteoglycan stability and chondrocyte maturation Article Snippet: For routine passaging, all cells listed above were detached using 0.05% trypsin-EDTA (Thermo), sub-cultured every 3 to 4 days, and revived from liquid nitrogen after ≤ 10 passages. .. HEK293T cells were co-transfected with Fugene 6 (Promega) and 4 μg each of a viral envelope plasmid (pMD2.g, a gift from Didier Trono and purchased from Addgene, #12259), packaging plasmid (psPAX2, a gift from Didier Trono and purchased from Addgene, #12260), and Plasmid Preparation:Article Title: Enhanced production of sabinene by engineered Saccharomyces cerevisiae from corn hydrolysates Article Snippet: recently, advanced biofuels [1–3].. IPP and DMAPP, derived from both the mevalonate (MVA) pathway and methylerythritol phosphate (MEP) pathway, are condensed to geranyl diphosphate (GPP, precursor to monoterpene) by GPP synthase, which is further converted to monoterpene by various monoterpene synthases [4, 5].. Sabinene is a type of bicyclic monoterpene found in a variety of essential oils of plants, including Salvia officinalis and Origanum species, and is widely used in culinary spices, perfume additives and fine chemicals [6–9]. Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Article Title: Development of Potent and Selective RIPK1 Degraders Targeting Its Non-Enzymatic Function for Cancer Treatment Article Snippet: .. 26 Guide RNA oligos for RIPK1 (foward: CACCGAGCCCATCCAGGGTTAGTTC. reverse: AAACGAACTAACCCTGGATGGGCTC) were cloned into Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Article Title: Loss of PTDSS1 in tumor cells improves immunogenicity and response to anti-PD-1 therapy. Article Snippet: .. Mouse bladder cancer cell line MB49 (Sigma- Aldrich, SCC148) was first transduced with Article Title: Mucin-type O -glycans regulate proteoglycan stability and chondrocyte maturation Article Snippet: For routine passaging, all cells listed above were detached using 0.05% trypsin-EDTA (Thermo), sub-cultured every 3 to 4 days, and revived from liquid nitrogen after ≤ 10 passages. .. HEK293T cells were co-transfected with Fugene 6 (Promega) and 4 μg each of a viral envelope plasmid (pMD2.g, a gift from Didier Trono and purchased from Addgene, #12259), packaging plasmid (psPAX2, a gift from Didier Trono and purchased from Addgene, #12260), and Article Title: Loss of PTDSS1 in tumor cells improves immunogenicity and response to anti–PD-1 therapy Article Snippet: .. Mouse bladder cancer cell line MB49 (Sigma-Aldrich, SCC148) was first transduced with Transformation Assay:Article Title: Enhanced production of sabinene by engineered Saccharomyces cerevisiae from corn hydrolysates Article Snippet: recently, advanced biofuels [1–3].. IPP and DMAPP, derived from both the mevalonate (MVA) pathway and methylerythritol phosphate (MEP) pathway, are condensed to geranyl diphosphate (GPP, precursor to monoterpene) by GPP synthase, which is further converted to monoterpene by various monoterpene synthases [4, 5].. Sabinene is a type of bicyclic monoterpene found in a variety of essential oils of plants, including Salvia officinalis and Origanum species, and is widely used in culinary spices, perfume additives and fine chemicals [6–9]. Derivative Assay:Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Mutagenesis:Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Introduce:Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Activity Assay:Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Article Title: A CRISPR/Cas9-based system using dual-sgRNAs for efficient gene deletion in Mycobacterium abscessus Article Snippet: .. The Clone Assay:Article Title: Development of Potent and Selective RIPK1 Degraders Targeting Its Non-Enzymatic Function for Cancer Treatment Article Snippet: .. 26 Guide RNA oligos for RIPK1 (foward: CACCGAGCCCATCCAGGGTTAGTTC. reverse: AAACGAACTAACCCTGGATGGGCTC) were cloned into Transfection:Article Title: Development of Potent and Selective RIPK1 Degraders Targeting Its Non-Enzymatic Function for Cancer Treatment Article Snippet: .. 26 Guide RNA oligos for RIPK1 (foward: CACCGAGCCCATCCAGGGTTAGTTC. reverse: AAACGAACTAACCCTGGATGGGCTC) were cloned into Transduction:Article Title: Loss of PTDSS1 in tumor cells improves immunogenicity and response to anti-PD-1 therapy. Article Snippet: .. Mouse bladder cancer cell line MB49 (Sigma- Aldrich, SCC148) was first transduced with Article Title: Loss of PTDSS1 in tumor cells improves immunogenicity and response to anti–PD-1 therapy Article Snippet: .. Mouse bladder cancer cell line MB49 (Sigma-Aldrich, SCC148) was first transduced with Selection:Article Title: Loss of PTDSS1 in tumor cells improves immunogenicity and response to anti-PD-1 therapy. Article Snippet: .. Mouse bladder cancer cell line MB49 (Sigma- Aldrich, SCC148) was first transduced with Article Title: Loss of PTDSS1 in tumor cells improves immunogenicity and response to anti–PD-1 therapy Article Snippet: .. Mouse bladder cancer cell line MB49 (Sigma-Aldrich, SCC148) was first transduced with Stable Transfection:Article Title: Loss of PTDSS1 in tumor cells improves immunogenicity and response to anti-PD-1 therapy. Article Snippet: .. Mouse bladder cancer cell line MB49 (Sigma- Aldrich, SCC148) was first transduced with Article Title: Loss of PTDSS1 in tumor cells improves immunogenicity and response to anti–PD-1 therapy Article Snippet: .. Mouse bladder cancer cell line MB49 (Sigma-Aldrich, SCC148) was first transduced with |
